Comparison of diagnostic accuracies of rapid serological tests and ELISA

Comparison of diagnostic accuracies of rapid serological tests and ELISA to molecular diagnostics in patients with suspected coronavirus disease 2019 presenting to the hospital

Objectives: To assess the diagnostic performance of rapid lateral flow immunochromatographic assays (LFAs) compared with an ELISA and nucleic acid amplification tests (NATs) in individuals with suspected coronavirus disease 2019 (COVID-19).
Methods: Patients presenting to a Dutch teaching hospital were eligible between 17 March and 10 April 2020, when they had respiratory symptoms that were suspected for COVID-19. The performances of six different LFAs were evaluated in plasma samples obtained on corresponding respiratory sample dates of NATs testing. Subsequently, the best performing LFA was evaluated in 228 patients and in 50 sera of a historical patient control group.
Results: In the pilot analysis, sensitivity characteristics of LFA were heterogeneous, ranging from 2/20 (10%; 95% CI 0%-23%) to 11/20 (55%; 95% CI 33%-77%). In the total cohort, Orient Gene Biotech COVID-19 IgG/IgM Rapid Test LFA had a sensitivity of 43/99 (43%; 95% CI 34%-53%) and specificity of 126/129 (98%; 95% CI 95%-100%).
Sensitivity increased to 31/52 (60%; 95% CI 46%-73%) in patients with at least 7 days of symptoms, and to 21/33 (64%; 95% CI 47%-80%) in patients with C-reactive protein (CRP) ≥100 mg/L. Sensitivity and specificity of Wantai SARS-CoV-2 Ab ELISA was 59/95 (62%; 95% CI 52%-72%) and 125/128 (98%; 95% CI 95%-100%) in all patients, respectively, but sensitivity increased to 38/48 (79%; 95% CI 68%-91%) in patients with at least 7 days of symptoms.
Conclusions: There is large variability in diagnostic test performance between rapid LFAs, but overall limited sensitivity and high specificity in acutely admitted patients. Sensitivity improved in patients with longer existing symptoms or high CRP. LFAs should only be considered as additional triage tools when these may lead to the improvement of hospital logistics.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Adiponectin (human) ELISA Assay Kit

EUR 898

Adiponectin (mouse) Elisa Assay Kit

EUR 865

Adiponectin (rat) Elisa Assay Kit

EUR 843

Visfatin (human) Elisa Assay Kit

EUR 985

Adiponectin (human) Elisa Assay Kit

K2192-96 96 assays
EUR 1017

Adiponectin (mouse) Elisa Assay Kit

K2193-96 96 assays
EUR 1017

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9


30007 1KIT
EUR 236
Description: Minimum order quantity: 1 unit of 1KIT

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Glycosaminoglycans Assay Kit

6022 1 kit
EUR 419.75
Description: Glycosaminoglycans Assay Kit

DNA Assay Kit

6023 1 kit
EUR 180.5
Description: DNA Assay Kit

Hemoglobin Assay Kit

6024 1 kit
EUR 180.5
Description: Hemoglobin Assay Kit

Proteasome Assay Kit

55R-1341 100 assays
EUR 654
Description: Assay Kit for detection of Proteasome in the research laboratory

Calpain Assay Kit

55R-1342 100 assays
EUR 779
Description: Assay Kit for detection of Calpain in the research laboratory

Glutathione Assay Kit

55R-1343 100 assays
EUR 654
Description: Assay Kit for detection of Glutathione in the research laboratory

Glutathione Assay Kit

55R-1354 100 assays
EUR 895
Description: Assay Kit for detection of Glutathione activity in the research laboratory

HDAC Assay Kit

55R-1371 100 assays
EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HDAC Assay Kit

55R-1372 100 assays
EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HAT Assay Kit

55R-1373 100 assays
EUR 740
Description: Assay Kit for detection of HAT in the research laboratory

SOD Assay Kit

55R-1374 100 assays
EUR 602
Description: Assay Kit for detection of SOD in the research laboratory

HDAC3 Assay Kit

55R-1377 100 assays
EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC8 Assay Kit

55R-1379 100 assays
EUR 689
Description: Assay Kit for detection of HDAC8 in the research laboratory

ATP Assay Kit

55R-1380 100 assays
EUR 809
Description: Assay Kit for detection of ATP in the research laboratory

ADP Assay Kit

55R-1381 100 assays
EUR 809
Description: Assay Kit for detection of ADP in the research laboratory

FAD Assay Kit

55R-1382 100 assays
EUR 732
Description: Assay Kit for detection of FAD in the research laboratory

PEP Assay Kit

55R-1384 100 assays
EUR 876
Description: Assay Kit for detection of PEP in the research laboratory

Ammonia Assay Kit

55R-1388 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

cAMP Assay Kit

55R-1389 100 assays
EUR 706
Description: Assay Kit for detection of cAMP activity in the research laboratory

cGMP Assay Kit

55R-1390 100 assays
EUR 706
Description: Assay Kit for detection of cGMP activity in the research laboratory

Urea Assay Kit

55R-1391 100 assays
EUR 740
Description: Assay Kit for detection of Urea in the research laboratory

Calcium Assay Kit

55R-1392 250 assays
EUR 586
Description: Assay Kit for detection of Calcium activity in the research laboratory

Magnesium Assay Kit

55R-1393 100 assays
EUR 654
Description: Assay Kit for detection of Magnesium in the research laboratory

Zinc Assay Kit

55R-1394 100 assays
EUR 673
Description: Assay Kit for detection of Zinc in the research laboratory

Iron Assay Kit

55R-1395 100 assays
EUR 758
Description: Assay Kit for detection of Iron in the research laboratory

Phosphate Assay Kit

55R-1400 500 assays
EUR 415
Description: Assay Kit for detection of Phosphate in the research laboratory

JNK Assay Kit

55R-1407 40 assays
EUR 868
Description: Assay Kit for detection of JNK in the research laboratory

JNK Assay Kit

55R-1408 40 assays
EUR 979
Description: Assay Kit for detection of JNK in the research laboratory

Akt Assay Kit

55R-1409 40 assays
EUR 979
Description: Assay Kit for detection of Akt in the research laboratory

Ammonia Assay Kit

55R-1410 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Cobalt Assay Kit

55R-1435 100 assays
EUR 621
Description: Assay Kit for detection of Cobalt in the research laboratory

Nickel Assay Kit

55R-1436 100 assays
EUR 621
Description: Assay Kit for detection of Nickel in the research laboratory

Chloride Assay Kit

55R-1437 100 assays
EUR 484
Description: Assay Kit for detection of Chloride in the research laboratory

Aspartate Assay Kit

55R-1438 100 assays
EUR 673
Description: Assay Kit for detection of Aspartate in the research laboratory

Hydroxyproline Assay Kit

55R-1439 100 assays
EUR 844
Description: Assay Kit for detection of Hydroxyproline in the research laboratory

Phenylalanine Assay Kit

55R-1442 100 assays
EUR 654
Description: Assay Kit for detection of Phenylalanine in the research laboratory

Phosphatidylcholine Assay Kit

55R-1443 100 assays
EUR 673
Description: Assay Kit for detection of Phosphatidylcholine in the research laboratory

Glucose Assay Kit

55R-1449 100 assays
EUR 706
Description: Assay Kit for detection of Glucose in the research laboratory

Lactate Assay Kit

55R-1450 100 assays
EUR 844
Description: Assay Kit for detection of Lactate in the research laboratory

Pyruvate Assay Kit

55R-1452 100 assays
EUR 844
Description: Assay Kit for detection of Pyruvate in the research laboratory

Adipogenesis Assay Kit

55R-1454 100 assays
EUR 586
Description: Assay Kit for detection of Adipogenesis in the research laboratory

Glucose Assay Kit

55R-1458 100 assays
EUR 740
Description: Assay Kit for detection of Glucose in the research laboratory

Galactose Assay Kit

55R-1459 100 assays
EUR 740
Description: Assay Kit for detection of Galactose in the research laboratory

Maltose Assay Kit

55R-1460 100 assays
EUR 723
Description: Assay Kit for detection of Maltose in the research laboratory

Fructose Assay Kit

55R-1461 100 assays
EUR 689
Description: Assay Kit for detection of Fructose in the research laboratory

Ethanol Assay Kit

55R-1462 100 assays
EUR 774
Description: Assay Kit for detection of Ethanol in the research laboratory

Galactose Assay Kit

55R-1463 100 assays
EUR 706
Description: Assay Kit for detection of Galactose in the research laboratory

Lactose Assay Kit

55R-1466 100 assays
EUR 706
Description: Assay Kit for detection of Lactose in the research laboratory

Creatinine Assay Kit

55R-1467 100 assays
EUR 638
Description: Assay Kit for detection of Creatinine in the research laboratory

Sucrose Assay Kit

55R-1468 100 assays
EUR 689
Description: Assay Kit for detection of Sucrose in the research laboratory

Lactate Assay Kit

55R-1469 100 assays
EUR 844
Description: Assay Kit for detection of Lactate in the research laboratory

Maltose Assay Kit

55R-1470 100 assays
EUR 706
Description: Assay Kit for detection of Maltose in the research laboratory

Glutamate Assay Kit

55R-1471 100 assays
EUR 740
Description: Assay Kit for detection of Glutamate in the research laboratory

Fumarate Assay Kit

55R-1475 100 assays
EUR 706
Description: Assay Kit for detection of Fumarate in the research laboratory

Creatine Assay Kit

55R-1476 100 assays
EUR 654
Description: Assay Kit for detection of Creatine in the research laboratory

Sarcosine Assay Kit

55R-1477 100 assays
EUR 654
Description: Assay Kit for detection of Sarcosine in the research laboratory

Malate Assay Kit

55R-1478 100 assays
EUR 673
Description: Assay Kit for detection of Malate in the research laboratory

Glycogen Assay Kit

55R-1481 100 assays
EUR 844
Description: Assay Kit for detection of Glycogen in the research laboratory

Starch Assay Kit

55R-1482 100 assays
EUR 673
Description: Assay Kit for detection of Starch in the research laboratory

Alanine Assay Kit

55R-1483 100 assays
EUR 654
Description: Assay Kit for detection of Alanine in the research laboratory

Formate Assay Kit

55R-1484 100 assays
EUR 809
Description: Assay Kit for detection of Formate in the research laboratory

Citrate Assay Kit

55R-1485 100 assays
EUR 740
Description: Assay Kit for detection of Citrate in the research laboratory

Isocitrate Assay Kit

55R-1486 100 assays
EUR 663
Description: Assay Kit for detection of Isocitrate in the research laboratory

Oxaloacetate Assay Kit

55R-1488 100 assays
EUR 663
Description: Assay Kit for detection of Oxaloacetate in the research laboratory

Heme Assay Kit

55R-1492 100 assays
EUR 673
Description: Assay Kit for detection of Heme in the research laboratory

Glucose Assay Kit

55R-1494 100 assays
EUR 706
Description: Assay Kit for detection of Glucose in the research laboratory

Amylase Assay Kit

55R-1503 100 assays
EUR 551
Description: Assay Kit for detection of Amylase in the research laboratory

Inosine Assay Kit

55R-1504 100 assays
EUR 732
Description: Assay Kit for detection of Inosine in the research laboratory

Aconitase Assay Kit

55R-1505 100 assays
EUR 689
Description: Assay Kit for detection of Aconitase in the research laboratory

Lipase Assay Kit

55R-1506 100 assays
EUR 706
Description: Assay Kit for detection of Lipase in the research laboratory

Lipase Assay Kit

55R-1507 100 assays
EUR 740
Description: Assay Kit for detection of Lipase in the research laboratory

Diagnostic performance of seven rapid IgG/IgM antibody tests and the Euroimmun IgA/IgG ELISA in COVID-19 patients

Methods: Specificity was evaluated in 103 samples collected before January 2020. Sensitivity and time to seropositivity was evaluated in 167 samples from 94 patients with COVID-19 confirmed with RT-PCR on nasopharyngeal swab.
Results: Specificity (confidence interval) of lateral flow assays (LFAs) was ≥91.3% (84.0-95.5) for IgM, ≥90.3% (82.9-94.8) for IgG, and ≥85.4% (77.2-91.1) for the combination IgM OR IgG. Specificity of the ELISA was 96.1% (90.1-98.8) for IgG and only 73.8% (64.5-81.4) for IgA. Sensitivity 14-25 days after the onset of symptoms was between ≥92.1% (78.5-98.0) and 100% (95.7-100) for IgG LFA compared to 89.5% (75.3-96.4) for IgG ELISA. Positivity of IgM OR IgG for LFA resulted in a decrease in specificity compared to IgG alone without a gain in diagnostic performance, except for VivaDiag.
The results for IgM varied significantly between the LFAs with an average overall agreement of only 70% compared to 89% for IgG. The average dynamic trend to seropositivity for IgM was not shorter than for IgG. At the time of hospital admission the sensitivity of LFA was <60%.
Conclusions: Sensitivity for the detection of IgG antibodies 14-25 days after the onset of symptoms was ≥92.1% for all seven LFAs compared to 89.5% for the IgG ELISA. The results for IgM varied significantly, and including IgM antibodies in addition to IgG for the interpretation of LFAs did not improve the diagnostic performance.

Association of Genetic Polymorphisms Related to Johne’s Disease With Estimated Breeding Values of Holstein Sires for Milk ELISATest Scores

Background: Johne’s disease (JD) is a chronic intestinal inflammatory disease caused by Mycobacterium avium subsp. paratuberculosis (MAP) infection in ruminants. Since there are currently no effective vaccine or treatment options available to control JD, genetic selection may be an alternative strategy to enhance JD resistance.
Numerous Single Nucleotide Polymorphisms (SNPs) have been reported to be associated with MAP infection status based on published genome-wide association and candidate gene studies. The main objective of this study was to validate these SNPs that were previously identified to be associated with JD by testing their effect on Holstein bulls’ estimated breeding values (EBVs) for milk ELISA test scores, an indirect indicator of MAP infection status in cattle.
Results: Three SNPs, rs41810662, rs41617133 and rs110225854, located on Bos taurus autosomes (BTA) 16, 23 and 26, respectively, were confirmed as significantly associated with Holstein bulls’ EBVs for milk ELISA test score (FDR < 0.01) based on General Quasi Likelihood Scoring analysis (GQLS) analysis. Single-SNP regression analysis identified four SNPs that were associated with sire EBVs (FDR < 0.05).
This includes two SNPs that were common with GQLS (rs41810662 and rs41617133), with the other two SNPs being rs110494981 and rs136182707, located on BTA9 and BTA16, respectively.
Conclusions: The findings of this study validate the association of SNPs with JD MAP infection status and highlight the need to further investigate the genomic regions harboring these SNPs.

ICK (Ab-159) Antibody

CSB-PA153658-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK (Ab-159). Recognizes ICK (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ICK (Ab-159) Conjugated Antibody

C33228 100ul
EUR 397

Anti-GAB2 (Ab-159) Antibody

A02386-2 100ul
EUR 397
Description: Rabbit Polyclonal GAB2 (Ab-159) Antibody. Validated in IHC, WB and tested in Human.

MAK (Ab-159) Antibody

33233-100ul 100ul
EUR 252

MAK (Ab-159) Antibody

33233-50ul 50ul
EUR 187

GAB2 (Ab-159) Antibody

33262-100ul 100ul
EUR 252

GAB2 (Ab-159) Antibody

33262-50ul 50ul
EUR 187

MAK (Ab-159) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAK (Ab-159). Recognizes MAK (Ab-159) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAK (Ab-159) Antibody

CSB-PA056397-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAK (Ab-159). Recognizes MAK (Ab-159) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GAB2 (Ab-159) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GAB2 (Ab-159). Recognizes GAB2 (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GAB2 (Ab-159) Antibody

CSB-PA781252-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GAB2 (Ab-159). Recognizes GAB2 (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

MAK (Ab-159) Conjugated Antibody

C33233 100ul
EUR 397

GAB2 (Ab-159) Conjugated Antibody

C33262 100ul
EUR 397

Anti-ICK Antibody

EUR 370

Anti-ICK Antibody

A06270 100ul
EUR 397
Description: Rabbit Polyclonal ICK Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-ICK antibody

PAab04108 100 ug
EUR 386

Anti-ICK antibody

STJ110093 100 µl
EUR 277
Description: Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified.

Anti-ICK antibody

STJ93636 200 µl
EUR 197
Description: Rabbit polyclonal to ICK.


YF-PA17639 100 ug
EUR 403
Description: Rabbit polyclonal to ICK


YF-PA25803 50 ul
EUR 334
Description: Mouse polyclonal to ICK

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

ICK antibody

70R-17871 50 ul
EUR 435
Description: Rabbit polyclonal ICK antibody

ICK antibody

70R-32214 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody

ICK Antibody

34122-100ul 100ul
EUR 252

ICK Antibody

34122-50ul 50ul
EUR 187

ICK Antibody

42899-100ul 100ul
EUR 252

ICK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ICK Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

ICK Antibody

CSB-PA278117-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

ICK antibody

70R-32652 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody

ICK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ICK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ICK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Anti-IGFBP7 (aa145-159) antibody

STJ71903 100 µg
EUR 359

Anti-ACACB (aa146-159) antibody

STJ72668 100 µg
EUR 260

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

abx234108-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

abx331322-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ICK antibody (Tyr159)

70R-32651 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody (Tyr159)

ICK Polyclonal Antibody

ABP54264-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ABP54264-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ABP54264-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ES5263-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ICK from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

ICK Polyclonal Antibody

ES5263-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ICK from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Ick/ Rat Ick ELISA Kit

ELI-13214r 96 Tests
EUR 886

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyanine 5 bisacid [equivalent to Cy5® bisacid]

159 5 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ICK (Phospho-Tyr159) Antibody

12825-100ul 100ul
EUR 252

ICK (Phospho-Tyr159) Antibody

12825-50ul 50ul
EUR 187

ICK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ICK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ICK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-ICK (Tyr159) Antibody

DF8739 200ul
EUR 304
Description: Phospho-ICK (Tyr159) Antibody detects endogenous levels of ICK only when phosphorylated at Tyr159.

Phospho-ICK (Tyr159) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-ICK (Y159) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ICK (Y159). Recognizes Phospho-ICK (Y159) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho- ICK (Tyr159) Antibody

ABD8739 100 ug
EUR 438


DB-159-0.1 100 μl
EUR 404
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-0.2 200 μl
EUR 587
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-0.5 500 μl
EUR 769
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-1 1 ml
EUR 1255
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280


HY-18988 10mM/1mL
EUR 113


HY-19025 1mg
EUR 849

Anti-Ikaros Purified

11-159-C025 0.025 mg
EUR 99

Anti-Ikaros Purified

11-159-C100 0.1 mg
EUR 158

Anti-Ikaros PE

1P-159-T025 25 tests
EUR 140

Anti-Ikaros PE

1P-159-T100 100 tests
EUR 240

Serine/Threonine Protein Kinase ICK (ICK) ELISA Kit

abx595304-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

ICK cloning plasmid

CSB-CL891800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgaatagatacacaacaatcaggcagctcggggatggaacctacggttccgtcctgctgggaagaagcattgagtctggggagctgatcgctattaaaaaaatgaaaagaaaattttattcctgggaggaatgcatgaaccttcgggaggttaagtctttaaagaagctcaacca
  • Show more
Description: A cloning plasmid for the ICK gene.

ICK Rabbit pAb

A7783-100ul 100 ul
EUR 308

ICK Rabbit pAb

A7783-200ul 200 ul
EUR 459

ICK Rabbit pAb

A7783-20ul 20 ul
EUR 183

ICK Rabbit pAb

A7783-50ul 50 ul
EUR 223

Intestinal Cell Kinase (ICK) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

abx331660-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Mouse Serine/threonine- protein kinase ICK, Ick ELISA KIT

ELI-43366m 96 Tests
EUR 865

Rat Serine/Threonine Protein Kinase ICK (ICK) ELISA Kit

abx391500-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Serine/Threonine-Protein Kinase ICK (ICK) ELISA Kit

abx387926-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Serine/Threonine Protein Kinase ICK (ICK) ELISA Kit

abx389647-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Serine/threonine- protein kinase ICK, ICK ELISA KIT

ELI-48312h 96 Tests
EUR 824

Rabbit Anti-Human CDK1 (aa 159-163) Polyclonal Antibody

CPB-1052RH 100 ul
EUR 460

Rabbit Anti-Human VASP Polyclonal Antibody (aa 155~159)

CPB-1098RH 100 ul
EUR 460

Anti-APLF (Ab-116) Antibody

A06828 100ul
EUR 397
Description: Rabbit Polyclonal APLF (Ab-116) Antibody. Validated in IHC, WB and tested in Human.