Comparison of diagnostic accuracies of rapid serological tests and ELISA

Comparison of diagnostic accuracies of rapid serological tests and ELISA to molecular diagnostics in patients with suspected coronavirus disease 2019 presenting to the hospital

Objectives: To assess the diagnostic performance of rapid lateral flow immunochromatographic assays (LFAs) compared with an ELISA and nucleic acid amplification tests (NATs) in individuals with suspected coronavirus disease 2019 (COVID-19).
Methods: Patients presenting to a Dutch teaching hospital were eligible between 17 March and 10 April 2020, when they had respiratory symptoms that were suspected for COVID-19. The performances of six different LFAs were evaluated in plasma samples obtained on corresponding respiratory sample dates of NATs testing. Subsequently, the best performing LFA was evaluated in 228 patients and in 50 sera of a historical patient control group.
Results: In the pilot analysis, sensitivity characteristics of LFA were heterogeneous, ranging from 2/20 (10%; 95% CI 0%-23%) to 11/20 (55%; 95% CI 33%-77%). In the total cohort, Orient Gene Biotech COVID-19 IgG/IgM Rapid Test LFA had a sensitivity of 43/99 (43%; 95% CI 34%-53%) and specificity of 126/129 (98%; 95% CI 95%-100%).
Sensitivity increased to 31/52 (60%; 95% CI 46%-73%) in patients with at least 7 days of symptoms, and to 21/33 (64%; 95% CI 47%-80%) in patients with C-reactive protein (CRP) ≥100 mg/L. Sensitivity and specificity of Wantai SARS-CoV-2 Ab ELISA was 59/95 (62%; 95% CI 52%-72%) and 125/128 (98%; 95% CI 95%-100%) in all patients, respectively, but sensitivity increased to 38/48 (79%; 95% CI 68%-91%) in patients with at least 7 days of symptoms.
Conclusions: There is large variability in diagnostic test performance between rapid LFAs, but overall limited sensitivity and high specificity in acutely admitted patients. Sensitivity improved in patients with longer existing symptoms or high CRP. LFAs should only be considered as additional triage tools when these may lead to the improvement of hospital logistics.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Adiponectin (human) Elisa Assay Kit

K2192-96 96 assays
EUR 1017

Adiponectin (mouse) Elisa Assay Kit

K2193-96 96 assays
EUR 1017

Adiponectin (human) ELISA Assay Kit

EUR 898

Adiponectin (mouse) Elisa Assay Kit

EUR 865

Adiponectin (rat) Elisa Assay Kit

EUR 843

Visfatin (human) Elisa Assay Kit

EUR 985

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Histamine Assay Kit

AKR-360 96 assays
EUR 519
Description: Histamine is naturally occurring in food, with high concentrations associated with spoiled and fermented foods. Exposure to high levels of histamine through the ingestion of food can cause symptoms similar to an allergic response. Our Histamine Assay Kit detects total histamine from food samples using a colorimetric probe. Reduction of the probe yields color development proportional the histamine levels in the sample. Absorbance at 450nm is read after a one hour incubation at 37C and histamine levels are calculated based on a histamine standard curve.

Glucose Assay Kit

abx090673-1Kit 1 Kit
EUR 237
  • Shipped within 5-10 working days.

ADA Assay Kit

abx090675-100tests 100 tests
EUR 237
  • Shipped within 5-10 working days.

Glutamate Assay Kit

abx096004-100Assays 100 Assays
EUR 441
  • Shipped within 5-10 working days.

Glutathione Assay Kit

abx096005-100Assays 100 Assays
EUR 378
  • Shipped within 5-10 working days.

Trehalase Assay Kit

abx096014-100Assays 100 Assays
EUR 551
  • Shipped within 5-10 working days.

Pyruvate Assay Kit

abx097982-100Assays 100 Assays
EUR 472
  • Shipped within 5-10 working days.

NADPase Assay Kit

abx097983-100Assays 100 Assays
EUR 504
  • Shipped within 5-10 working days.

Starch Assay Kit

abx097988-100Assays 100 Assays
EUR 441
  • Shipped within 5-10 working days.

Trehalose Assay Kit

abx097995-100Assays 100 Assays
EUR 472
  • Shipped within 5-10 working days.

ADA Assay Kit

abx098403-Hitachi7060R190ml2R290ml1 Hitachi 7060; R1: 90ml×2 R2: 90ml×1
EUR 739
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R140ml4R220ml4 Hitachi 7170; R1: 40ml×4 R2: 20ml×4
EUR 801
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R160ml4R260ml2 Hitachi 7170; R1: 60ml×4 R2: 60ml×2
EUR 911
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Toshiba40R150ml4R250ml2 Toshiba 40; R1: 50ml×4 R2: 50ml×2
EUR 786
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Hitachi7020R140ml2R240ml2 Hitachi 7020; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Hitachi7060R190ml1R290ml1 Hitachi 7060; R1: 90ml×1 R2: 90ml×1
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Toshiba40R140ml2R240ml2 Toshiba 40; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-UniversalR140ml2R240ml2 Universal; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 300
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R140ml3R230ml1 Hitachi 7170; R1: 40ml×3 R2: 30ml×1
EUR 316
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R160ml2R230ml1 Hitachi 7170; R1: 60ml×2 R2: 30ml×1
EUR 316
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Toshiba40R140ml4R240ml1 Toshiba 40; R1: 40ml×4 R2: 40ml×1
EUR 331
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-UniversalR160ml2R215ml2 Universal; R1: 60ml×2 R2: 15ml×2
EUR 316
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Hitachi7020R150ml3R250ml1 Hitachi 7020; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Hitachi7060R190ml2R260ml1 Hitachi 7060; R1: 90ml×2 R2: 60ml×1
EUR 472
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R140ml3R240ml1 Toshiba 120; R1: 40ml×3 R2: 40ml×1
EUR 566
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R150ml3R250ml1 Toshiba 120; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba40R150ml3R250ml1 Toshiba 40; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7020R140ml2R220ml1 Hitachi 7020; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 253
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 206
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R140ml12R240ml3 Hitachi 7170; R1: 40ml×12 R2: 40ml×3
EUR 222
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7020R140ml4R240ml1 Hitachi 7020; R1: 40ml×4 R2: 40ml×1
EUR 222
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 222
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7170R132ml4R28ml4 Hitachi 7170; R1: 32ml×4 R2: 8ml×4
EUR 222
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-BeckmanR140ml1R210ml1 Beckman; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 269
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Toshiba40R140ml1R210ml1 Toshiba 40; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Hitachi7060R160ml1R210ml1 Hitachi 7060; R1: 60ml×1 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Hitachi7170R130ml2R210ml1 Hitachi 7170; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Toshiba40R130ml2R210ml1 Toshiba 40; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-UniversalR130ml2R210ml1 Universal; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7170R140ml1R210ml1 Hitachi 7170; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7170R160ml1R215ml1 Hitachi 7170; R1:60ml×1 R2:15ml×1
EUR 222
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Toshiba40R140ml1R210ml1 Toshiba 40; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-BeckmanR180ml1R220ml1 Beckman; R1:80ml×1 R2:20ml×1
EUR 692
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1:40ml×2 R2:20ml×1
EUR 692
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Hitachi7170R160ml1R215ml1 Hitachi 7170; R1:60ml×1 R2:15ml×1
EUR 566
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Toshiba40R140ml1R210ml1 Toshiba 40; R1:40ml×1 R2:10ml×1
EUR 441
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-UniversalR120ml1R25ml1 Universal; R1:20ml×1 R2:5ml×1
EUR 316
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Hitachi7020R140ml2R240ml2 Hitachi 7020; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Hitachi7060R190ml1R290ml1 Hitachi 7060; R1: 90ml×1 R2: 90ml×1
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Toshiba40R140ml2R240ml2 Toshiba 40; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Toshiba40R150ml2R250ml2 Toshiba 40; R1: 50ml×2 R2: 50ml×2
EUR 206
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7060R150ml1R210ml1 Hitachi 7060; R1: 50ml×1 R2: 10ml×1
EUR 363
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7060R150ml3R230ml1 Hitachi 7060; R1: 50ml×3 R2: 30ml×1
EUR 363
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7170R125ml1R25ml1 Hitachi 7170; R1: 25ml×1 R2: 5ml×1
EUR 269
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7170R150ml1R210ml1 Hitachi 7170; R1: 50ml×1 R2: 10ml×1
EUR 363
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 692
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7170R140ml1R210ml1 Hitachi 7170; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Toshiba40R140ml1R210ml1 Toshiba 40; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 942
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 566
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Hitachi7170R140ml1R210ml1 Hitachi 7170; R1: 40ml×1 R2: 10ml×1
EUR 942
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Toshiba120R140ml1R210ml1 Toshiba 120; R1: 40ml×1 R2: 10ml×1
EUR 942
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Toshiba40R140ml1R210ml1 Toshiba 40; R1: 40ml×1 R2: 10ml×1
EUR 942
  • Shipped within 5-12 working days.

Prealbumin Assay Kit

abx098451-BeckmanR140ml1R210ml1 Beckman; R1: 40ml×1 R2: 10ml×1
EUR 222
  • Shipped within 5-12 working days.

Prealbumin Assay Kit

abx098451-Hitachi7170R132ml1R28ml1 Hitachi 7170; R1: 32ml×1 R2: 8ml×1
EUR 222
  • Shipped within 5-12 working days.

Prealbumin Assay Kit

abx098451-UniversalR160ml1R215ml1 Universal; R1: 60ml×1 R2: 15ml×1
EUR 253
  • Shipped within 5-12 working days.

Transferrin Assay Kit

abx098460-BeckmanR160ml1R220ml1 Beckman; R1: 60ml×1 R2: 20ml×1
EUR 660
  • Shipped within 5-12 working days.

Transferrin Assay Kit

abx098460-Hitachi7060R160ml2R240ml1 Hitachi 7060; R1: 60ml×2 R2: 40ml×1
EUR 504
  • Shipped within 5-12 working days.

Transferrin Assay Kit

abx098460-Hitachi7170R145ml2R230ml1 Hitachi 7170; R1: 45ml×2 R2: 30ml×1
EUR 582
  • Shipped within 5-12 working days.

Transferrin Assay Kit

abx098460-Hitachi7170R160ml8R240ml4 Hitachi 7170; R1: 60ml×8 R2: 40ml×4
EUR 535
  • Shipped within 5-12 working days.

Transferrin Assay Kit

abx098460-Toshiba40R145ml2R230ml1 Toshiba 40; R1: 45ml×2 R2: 30ml×1
EUR 582
  • Shipped within 5-12 working days.

Triglycerides Assay Kit

abx098461-Hitachi7020R140ml4R240ml1 Hitachi 7020; R1: 40ml×4 R2: 40ml×1
EUR 284
  • Shipped within 5-12 working days.

Triglycerides Assay Kit

abx098461-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 269
  • Shipped within 5-12 working days.

Triglycerides Assay Kit

abx098461-Hitachi7170R132ml4R28ml4 Hitachi 7170; R1: 32ml×4 R2: 8ml×4
EUR 300
  • Shipped within 5-12 working days.

Triglycerides Assay Kit

abx098461-Toshiba40R140ml4R240ml1 Toshiba 40; R1: 40ml×4 R2: 40ml×1
EUR 284
  • Shipped within 5-12 working days.

Urea Assay Kit

abx098464-Hitachi7020R150ml4R250ml1 Hitachi 7020; R1: 50ml×4 R2: 50ml×1
EUR 222
  • Shipped within 5-12 working days.

Urea Assay Kit

abx098464-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 222
  • Shipped within 5-12 working days.

Urea Assay Kit

abx098464-Toshiba120R140ml4R240ml1 Toshiba 120; R1: 40ml×4 R2: 40ml×1
EUR 222
  • Shipped within 5-12 working days.

AMBP Assay Kit

abx098467-Hitachi7060R145ml1R215ml1 Hitachi 7060; R1: 45ml×1 R2: 15ml×1
EUR 488
  • Shipped within 5-12 working days.

AMBP Assay Kit

abx098467-Hitachi7060R190ml2R230ml2 Hitachi 7060; R1: 90ml×2 R2: 30ml×2
EUR 519
  • Shipped within 5-12 working days.

AMBP Assay Kit

abx098467-Hitachi7170R145ml1R215ml1 Hitachi 7170; R1: 45ml×1 R2: 15ml×1
EUR 488
  • Shipped within 5-12 working days.

AMBP Assay Kit

abx098467-Toshiba40R145ml1R215ml1 Toshiba 40; R1: 45ml×1 R2: 15ml×1
EUR 488
  • Shipped within 5-12 working days.

Catalase Assay Kit

abx294001-96tests 96 tests
EUR 324
  • Shipped within 5-12 working days.

Hexokinase Assay Kit

abx294009-100tubes96samples 100 tubes/96 samples
EUR 519
  • Shipped within 5-12 working days.

Ceruloplasmin Assay Kit

abx298825-100Assays 100 Assays
EUR 394
  • Shipped within 5-10 working days.

Diagnostic performance of seven rapid IgG/IgM antibody tests and the Euroimmun IgA/IgG ELISA in COVID-19 patients

Methods: Specificity was evaluated in 103 samples collected before January 2020. Sensitivity and time to seropositivity was evaluated in 167 samples from 94 patients with COVID-19 confirmed with RT-PCR on nasopharyngeal swab.
Results: Specificity (confidence interval) of lateral flow assays (LFAs) was ≥91.3% (84.0-95.5) for IgM, ≥90.3% (82.9-94.8) for IgG, and ≥85.4% (77.2-91.1) for the combination IgM OR IgG. Specificity of the ELISA was 96.1% (90.1-98.8) for IgG and only 73.8% (64.5-81.4) for IgA. Sensitivity 14-25 days after the onset of symptoms was between ≥92.1% (78.5-98.0) and 100% (95.7-100) for IgG LFA compared to 89.5% (75.3-96.4) for IgG ELISA. Positivity of IgM OR IgG for LFA resulted in a decrease in specificity compared to IgG alone without a gain in diagnostic performance, except for VivaDiag.
The results for IgM varied significantly between the LFAs with an average overall agreement of only 70% compared to 89% for IgG. The average dynamic trend to seropositivity for IgM was not shorter than for IgG. At the time of hospital admission the sensitivity of LFA was <60%.
Conclusions: Sensitivity for the detection of IgG antibodies 14-25 days after the onset of symptoms was ≥92.1% for all seven LFAs compared to 89.5% for the IgG ELISA. The results for IgM varied significantly, and including IgM antibodies in addition to IgG for the interpretation of LFAs did not improve the diagnostic performance.

Association of Genetic Polymorphisms Related to Johne’s Disease With Estimated Breeding Values of Holstein Sires for Milk ELISATest Scores

Background: Johne’s disease (JD) is a chronic intestinal inflammatory disease caused by Mycobacterium avium subsp. paratuberculosis (MAP) infection in ruminants. Since there are currently no effective vaccine or treatment options available to control JD, genetic selection may be an alternative strategy to enhance JD resistance.
Numerous Single Nucleotide Polymorphisms (SNPs) have been reported to be associated with MAP infection status based on published genome-wide association and candidate gene studies. The main objective of this study was to validate these SNPs that were previously identified to be associated with JD by testing their effect on Holstein bulls’ estimated breeding values (EBVs) for milk ELISA test scores, an indirect indicator of MAP infection status in cattle.
Results: Three SNPs, rs41810662, rs41617133 and rs110225854, located on Bos taurus autosomes (BTA) 16, 23 and 26, respectively, were confirmed as significantly associated with Holstein bulls’ EBVs for milk ELISA test score (FDR < 0.01) based on General Quasi Likelihood Scoring analysis (GQLS) analysis. Single-SNP regression analysis identified four SNPs that were associated with sire EBVs (FDR < 0.05).
This includes two SNPs that were common with GQLS (rs41810662 and rs41617133), with the other two SNPs being rs110494981 and rs136182707, located on BTA9 and BTA16, respectively.
Conclusions: The findings of this study validate the association of SNPs with JD MAP infection status and highlight the need to further investigate the genomic regions harboring these SNPs.

ICK (Ab-159) Antibody

CSB-PA153658-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK (Ab-159). Recognizes ICK (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ICK (Ab-159) Conjugated Antibody

C33228 100ul
EUR 397

Anti-GAB2 (Ab-159) Antibody

A02386-2 100ul
EUR 397
Description: Rabbit Polyclonal GAB2 (Ab-159) Antibody. Validated in IHC, WB and tested in Human.

MAK (Ab-159) Antibody

33233-100ul 100ul
EUR 252

MAK (Ab-159) Antibody

33233-50ul 50ul
EUR 187

GAB2 (Ab-159) Antibody

33262-100ul 100ul
EUR 252

GAB2 (Ab-159) Antibody

33262-50ul 50ul
EUR 187

MAK (Ab-159) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAK (Ab-159). Recognizes MAK (Ab-159) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAK (Ab-159) Antibody

CSB-PA056397-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAK (Ab-159). Recognizes MAK (Ab-159) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GAB2 (Ab-159) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GAB2 (Ab-159). Recognizes GAB2 (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GAB2 (Ab-159) Antibody

CSB-PA781252-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GAB2 (Ab-159). Recognizes GAB2 (Ab-159) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

MAK (Ab-159) Conjugated Antibody

C33233 100ul
EUR 397

GAB2 (Ab-159) Conjugated Antibody

C33262 100ul
EUR 397

Anti-ICK Antibody

EUR 370

Anti-ICK Antibody

A06270 100ul
EUR 397
Description: Rabbit Polyclonal ICK Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-ICK antibody

PAab04108 100 ug
EUR 386

Anti-ICK antibody

STJ110093 100 µl
EUR 277
Description: Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified.

Anti-ICK antibody

STJ93636 200 µl
EUR 197
Description: Rabbit polyclonal to ICK.


YF-PA17639 100 ug
EUR 403
Description: Rabbit polyclonal to ICK


YF-PA25803 50 ul
EUR 334
Description: Mouse polyclonal to ICK

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

ICK antibody

70R-17871 50 ul
EUR 435
Description: Rabbit polyclonal ICK antibody

ICK antibody

70R-32214 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody

ICK Antibody

34122-100ul 100ul
EUR 252

ICK Antibody

34122-50ul 50ul
EUR 187

ICK Antibody

42899-100ul 100ul
EUR 252

ICK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ICK Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

ICK Antibody

CSB-PA278117-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

ICK antibody

70R-32652 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody

ICK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ICK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ICK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ICK. Recognizes ICK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Anti-IGFBP7 (aa145-159) antibody

STJ71903 100 µg
EUR 359

Anti-ACACB (aa146-159) antibody

STJ72668 100 µg
EUR 260

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

abx234108-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

abx331322-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Protein Kinase ICK (ICK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ICK antibody (Tyr159)

70R-32651 100 ug
EUR 327
Description: Rabbit polyclonal ICK antibody (Tyr159)

ICK Polyclonal Antibody

ABP54264-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ABP54264-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ABP54264-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ICK from Human, Mouse, Rat. This ICK antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ICK at AA rangle: 210-290

ICK Polyclonal Antibody

ES5263-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ICK from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

ICK Polyclonal Antibody

ES5263-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ICK from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Ick/ Rat Ick ELISA Kit

ELI-13214r 96 Tests
EUR 886

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase ICK (ICK) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyanine 5 bisacid [equivalent to Cy5® bisacid]

159 5 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ICK (Phospho-Tyr159) Antibody

12825-100ul 100ul
EUR 252

ICK (Phospho-Tyr159) Antibody

12825-50ul 50ul
EUR 187

ICK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ICK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ICK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ICK. Recognizes ICK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-ICK (Tyr159) Antibody

DF8739 200ul
EUR 304
Description: Phospho-ICK (Tyr159) Antibody detects endogenous levels of ICK only when phosphorylated at Tyr159.

Phospho-ICK (Tyr159) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-ICK (Y159) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ICK (Y159). Recognizes Phospho-ICK (Y159) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho- ICK (Tyr159) Antibody

ABD8739 100 ug
EUR 438


DB-159-0.1 100 μl
EUR 404
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-0.2 200 μl
EUR 587
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-0.5 500 μl
EUR 769
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-159-1 1 ml
EUR 1255
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


HY-18988 10mM/1mL
EUR 113


HY-19025 1mg
EUR 849

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Serine/Threonine Protein Kinase ICK (ICK) ELISA Kit

abx595304-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Anti-Ikaros Purified

11-159-C025 0.025 mg
EUR 99

Anti-Ikaros Purified

11-159-C100 0.1 mg
EUR 158

Anti-Ikaros PE

1P-159-T025 25 tests
EUR 140

Anti-Ikaros PE

1P-159-T100 100 tests
EUR 240

ICK cloning plasmid

CSB-CL891800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgaatagatacacaacaatcaggcagctcggggatggaacctacggttccgtcctgctgggaagaagcattgagtctggggagctgatcgctattaaaaaaatgaaaagaaaattttattcctgggaggaatgcatgaaccttcgggaggttaagtctttaaagaagctcaacca
  • Show more
Description: A cloning plasmid for the ICK gene.

ICK Rabbit pAb

A7783-100ul 100 ul
EUR 308

ICK Rabbit pAb

A7783-200ul 200 ul
EUR 459

ICK Rabbit pAb

A7783-20ul 20 ul
EUR 183

ICK Rabbit pAb

A7783-50ul 50 ul
EUR 223

Intestinal Cell Kinase (ICK) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intestinal Cell Kinase (ICK) Antibody

abx331660-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Anti-APLF (Ab-116) Antibody

A06828 100ul
EUR 397
Description: Rabbit Polyclonal APLF (Ab-116) Antibody. Validated in IHC, WB and tested in Human.

Anti-Kir5.1 (Ab-416) Antibody

A10858 100ul
EUR 397
Description: Rabbit Polyclonal Kir5.1 (Ab-416) Antibody. Validated in IF, IHC, WB and tested in Human.

Anti-GABRB1(Ab-434) Antibody

A04752 100ul
EUR 397
Description: Rabbit Polyclonal GABRB1(Ab-434) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-MSK2 (Ab-568) Antibody

A05545 100ul
EUR 397
Description: Rabbit Polyclonal MSK2 (Ab-568) Antibody. Validated in WB and tested in Human, Mouse.

Anti-JunD (Ab-255) Antibody

A05609-2 100ul
EUR 397
Description: Rabbit Polyclonal JunD (Ab-255) Antibody. Validated in IF, IHC, WB and tested in Human.

Anti-CPI17a(Ab-38) Antibody

A05752 100ul
EUR 397
Description: Rabbit Polyclonal CPI17a(Ab-38) Antibody. Validated in IF and tested in Human, Mouse, Rat.

Anti-Smad1 (Ab-465) Antibody

A00728-3 100ul
EUR 397
Description: Rabbit Polyclonal Smad1 (Ab-465) Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GSK3b (Ab-9) Antibody

A00791-1 100ul
EUR 397
Description: Rabbit Polyclonal GSK3b (Ab-9) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Shc1 (Ab-349) Antibody

A00796-1 100ul
EUR 397
Description: Rabbit Polyclonal Shc1 (Ab-349) Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Shc1 (Ab-427) Antibody

A00796-2 100ul
EUR 397
Description: Rabbit Polyclonal Shc1 (Ab-427) Antibody. Validated in IF, IHC, WB and tested in Human.

Anti-eIF4B(Ab-422) Antibody

A00846 100ul
EUR 397
Description: Rabbit Polyclonal eIF4B(Ab-422) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-VEGFR2 (Ab-1214) Antibody

A00901-4 100ul
EUR 397
Description: Rabbit Polyclonal VEGFR2 (Ab-1214) Antibody. Validated in IF, IHC and tested in Human, Mouse, Rat.

Anti-ASK1 (Ab-966) Antibody

A00929-2 100ul
EUR 397
Description: Rabbit Polyclonal ASK1 (Ab-966) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.