Lab Reagents
Biotium Laboratories manufactures the biotium sds reagents distributed by Genprice. The Biotium Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Biotium. Other Biotium products are available in stock. Specificity: Biotium Category: Sds
Test Assays information
anti-SDS |
YF-PA17352 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SDS |
dAbs scaffold protein anti-Human B5R |
SDS-L073 |
Creative Biolabs |
1 mg |
EUR 4496 |
Description: Scaffold protein |
TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution |
A0030 |
BBI Biotech |
4L |
EUR 94.8 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
TT-SDS (Tris-Tricine-SDS buffer) Premix powder |
TD8135 |
BBI Biotech |
1PK, 10L |
EUR 76.1 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
TG-SDS, 10X (Tris-Glycine SDS), pH 8.4 |
UA0030 |
BBI Biotech |
500ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
SDS cloning plasmid |
CSB-CL020926HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 657
- Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
- Show more
|
Description: A cloning plasmid for the SDS gene. |
SDS Rabbit pAb |
A12898-100ul |
Abclonal |
100 ul |
EUR 308 |
SDS Rabbit pAb |
A12898-200ul |
Abclonal |
200 ul |
EUR 459 |
SDS Rabbit pAb |
A12898-20ul |
Abclonal |
20 ul |
EUR 183 |
SDS Rabbit pAb |
A12898-50ul |
Abclonal |
50 ul |
EUR 223 |
SDS Blocking Peptide |
33R-4446 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762 |
SDS Blocking Peptide |
33R-1011 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399 |
SDS Polyclonal Antibody |
27842-100ul |
SAB |
100ul |
EUR 252 |
SDS Polyclonal Antibody |
27842-50ul |
SAB |
50ul |
EUR 187 |